circad | circRNAs associated with diseases

hsa_circ_0000467
Gene	SKA3	Organism	Human
Genome Locus	chr13:21742126-21742538:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30461077
Experimental Method
Sample Type	Tissues	Comparison	A total of 51 pairs of gastric cancer tissue samples and adjacent nontumor tissue samples
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AATGGGACTTAAAAATGCGAGG Reverse GTTGTGGACTACGTGGAGACT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Lu, J, Zhang, PY, Xie, JW, Wang, JB, Lin, JX, Chen, QY, Cao, LL, Huang, CM, Li, P, Zheng, CH (2019). Hsa_circ_0000467 promotes cancer progression and serves as a diagnostic and prognostic biomarker for gastric cancer. J. Clin. Lab. Anal., 33, 3:e22726.